Primers and probes described by WHO for diagnostic detection of Wuhan coronavirus 2019 by real-time RT-PCR

Note that standard, non-optimized reaction conditions as indicated by suppliers of one-step RT-PCR kits will generally yield sufficient sensitivity

Assay/ Use Oligonucleotide ID Sequence (5’–3’) Comment
RdRP gene RdRP_SARSr-F2 GTGARATGGTCATGTGTGGCGG use 600 nM per reaction
RdRP_SARSr-R1 CARATGTTAAASACACTATTAGCATA use 800 nM per reaction
RdRP_SARSr-P2 FAM-CAGGTGGAACCTCATCAGGAGATGC-BBQ Specific for Wuhan-CoV, will not detect SARS-CoV use 100 nM per reaction and mix with P0
RdRP_SARSr-P1 FAM-CCAGGTGGWACRTCATCMGGTGATGC-BBQ Pan Sarbeco-Probe, will detect Wuhan virus, SARS-CoV and bat-SARS-related CoVs use 100 nM per reaction and mix with P2
E gene E gene E_Sarbeco_F1 ACAGGTACGTTAATAGTTAATAGCGT use 400 nM per reaction
E_Sarbeco_R2 ATATTGCAGCAGTACGCACACA use 400 nM per reaction
E_Sarbeco_P1 FAM-ACACTAGCCATCCTTACTGCGCTTCG-BBQ use 200 nM per reaction
N gene N gene N_Sarbeco_F1 CACATTGGCACCCGCAATC use 600 nM per reaction
N_Sarbeco_R1 GAGGAACGAGAAGAGGCTTG use 800 nM per reaction
N_Sarbeco_P1 AM-ACTTCCTCAAGGAACAACATTGCCA-BBQ use 200 nM per reaction



W is A/T; R is G/A; M is A/C ; FAM, 6-carboxyfluorescein; BBQ, blackberry quencher